View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9756_2 (Length: 350)
Name: NF9756_2
Description: NF9756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9756_2 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 157 - 350
Target Start/End: Complemental strand, 16758022 - 16757831
Alignment:
| Q |
157 |
ctaaccttttatcttctgtcctcacatttcacttagcagagttggtgcattttctaaattccattgccattgtcctcttttctccatattgttcatgtct |
256 |
Q |
| |
|
||||||| ||| ||| |||||||| |||||| |||||||||| | || |||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
16758022 |
ctaacctattaccttgtgtcctcatatttcatttagcagagtcgatgtattttctaaattccatcgtcattgtcctcttttctccatattgttcatgtct |
16757923 |
T |
 |
| Q |
257 |
cttcatgaacattctttcctctccatatttttagatgtatcactaacaatcttacttgactctaactcaggtatgcaaatttgtgtcactcaga |
350 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16757922 |
cttcatgaacattctttc--ctccatatttttagatatatcactaacaatcttacttgactctaactcaggtatgcaaatttgtgtcactcaga |
16757831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 296 - 328
Target Start/End: Complemental strand, 32741909 - 32741877
Alignment:
| Q |
296 |
tcactaacaatcttacttgactctaactcaggt |
328 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
32741909 |
tcactaacaatctgacttgactctaactcaggt |
32741877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University