View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9756_3 (Length: 350)
Name: NF9756_3
Description: NF9756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9756_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 6e-68; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 121 - 285
Target Start/End: Complemental strand, 2516802 - 2516645
Alignment:
| Q |
121 |
atttggtttagtaattggaatttgtgttattctctttaaatttgctactgtctgcaactaatttagtggcactgttatttcaacaaaatccattaccatt |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2516802 |
atttgctttagtaattggaatttgtgttattctttttaaatttgctactgtctgcaactaatttagtggcactgttatttcaacaaaatccattaccatt |
2516703 |
T |
|
| Q |
221 |
accgtttatttatgtgagtaaactgactaagtttacttcatgtgcaaattgacgatgattagtag |
285 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2516702 |
accgtttat-------agtaaactgactaagtttacttcatgtgcaaattgacgatgattagtag |
2516645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 3 - 53
Target Start/End: Complemental strand, 2524460 - 2524410
Alignment:
| Q |
3 |
tgactcaacggttcatttctttgcactcgtcttcttttaccttctaatgct |
53 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
2524460 |
tgactcaacacttcatttctttgcactcatcttcttttgccttctaatgct |
2524410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 309 - 338
Target Start/End: Complemental strand, 2516637 - 2516608
Alignment:
| Q |
309 |
atgagatgcagggatggtcattaatatatt |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2516637 |
atgagatgcagggatggtcattaatatatt |
2516608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University