View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9756_7 (Length: 317)
Name: NF9756_7
Description: NF9756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9756_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 36 - 148
Target Start/End: Complemental strand, 44656222 - 44656110
Alignment:
| Q |
36 |
tcaaagaacaagcattatgcataaagcgaagccgaatgagatgtttaaaagggaacagtttaattataactctatgggtgggcaaacgaagaagactaca |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44656222 |
tcaaagaacaagcattatgcataaagcgaagccgaatgagatgtttaaaagggaacagtttaattataactctatgggtaggcaaacgaagaagactaca |
44656123 |
T |
 |
| Q |
136 |
aacaatagggaat |
148 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44656122 |
aacaatagggaat |
44656110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 198 - 317
Target Start/End: Complemental strand, 44656107 - 44655993
Alignment:
| Q |
198 |
cttataatctaagactagtaatcaattttttcagaaatatctcaaagttcatgatcctctaataatcgatttctacatcctgaaaatagatttatgtagt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44656107 |
cttataatctaagactagtaatcaattttttcagaaatatctcaaagttcatc-----ctaataatcgatttctacatcctgaaaatagatttatgtagt |
44656013 |
T |
 |
| Q |
298 |
tcaaaactgatttatgtacc |
317 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44656012 |
tcaaaactgatttatgtacc |
44655993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University