View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9757_high_13 (Length: 247)
Name: NF9757_high_13
Description: NF9757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9757_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 24935701 - 24935925
Alignment:
| Q |
1 |
catacgcaaaatacattaccacttgatagttgaatacgtagttttaaattgcagtctgcaaccgcaactgtgaacctaggatataaattttcgtgcattt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24935701 |
catactcaaaatacattaccacttgatagttgaatacgtagttttaaattgcagtctgcaaccgcaactgtgaacctaggatataaattttcgtgcattt |
24935800 |
T |
 |
| Q |
101 |
tactacgatataaatgtttgcagtgtaactgcaactacgatcacaatttaaaaccataatgaacgaggtcgagagtgaaatcaagacatataccttcaat |
200 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24935801 |
tactacgatataaaagtttgcagcgtaactgcaactacgatcacaatttaaaaccataatgaacgaggtcgagagtgaaatcaagac--ataccttcaat |
24935898 |
T |
 |
| Q |
201 |
ttcaactgattcgcacatgccaccaac |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
24935899 |
ttcaactgattcacacatgccaccaac |
24935925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 227
Target Start/End: Original strand, 42131255 - 42131291
Alignment:
| Q |
191 |
taccttcaatttcaactgattcgcacatgccaccaac |
227 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
42131255 |
taccttcaatttctactgattcacacatgccaccaac |
42131291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University