View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9757_low_22 (Length: 239)
Name: NF9757_low_22
Description: NF9757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9757_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 36276930 - 36276727
Alignment:
| Q |
1 |
caaaatagaaaatgcatgacaataaatttgacataataaaaatgttacttttttctggtcaaatgtttaatgacgatagtgtgaagaagtgacaggaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36276930 |
caaaatagaaaatgcatgacaataaatttgacataataaaaatgttacttttttctggtcaaatgtttaatgacgatagtgtgaagaagtgacaggaaat |
36276831 |
T |
|
| Q |
101 |
attcgagattttgctccaagaaa--tcaaaccttcacgcagctaataattgaactgtatttacataacatataattattggtaggtagtggtggtttgtt |
198 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36276830 |
attcgagattttgctccaagaaatctcaaaccttcacgcagctactaattgaattgtatttacataacatataattattggtaggtagtggtggtttgtt |
36276731 |
T |
|
| Q |
199 |
gtgg |
202 |
Q |
| |
|
|||| |
|
|
| T |
36276730 |
gtgg |
36276727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University