View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9757_low_26 (Length: 219)
Name: NF9757_low_26
Description: NF9757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9757_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 43941763 - 43941851
Alignment:
| Q |
1 |
atcttttttggacattcatgtcattggtgcaaaatatttattggttacctttgttgtctacgattgtctatctacaatatatatttaaa |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43941763 |
atcttttttggacattcatgtcattggtgcaaaatatttattggttacctttgttgtctacgattgtctatctacaacatatatttaaa |
43941851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 81 - 204
Target Start/End: Original strand, 43942034 - 43942160
Alignment:
| Q |
81 |
atatttaaataaagaggtatgtctcataaatacagtttaactca--gttatnnnnnnnt-ttcatttgcaggagtttgagttcaaatttaaactttttca |
177 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| | ||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43942034 |
atatttaaataaagaggtatgtctcgtaaatacagtttaaccgatagttataaaaaaatgttcatttgcaggagtttgagttcaaatttaaactttttca |
43942133 |
T |
 |
| Q |
178 |
ctaaacaatacaaggcgtgtaagttta |
204 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
43942134 |
ctaaacaatacaaggtgtgtaagttta |
43942160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University