View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9757_low_7 (Length: 410)
Name: NF9757_low_7
Description: NF9757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9757_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 194 - 394
Target Start/End: Complemental strand, 35674733 - 35674533
Alignment:
| Q |
194 |
ttacaatcaagcacattacaactggagnnnnnnnagtcttaaattgccgctatctaattccgtcaaagaccacttatgtggttgtttatggcgacatggc |
293 |
Q |
| |
|
|||||||||||||||||||||| | || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35674733 |
ttacaatcaagcacattacaaccgaagtttttttagttttaaattgccgctatctaattccgtcaaagaccacttatgtggttgtttatggcgacatggc |
35674634 |
T |
|
| Q |
294 |
atactagctgcataaagaaagagtaggtagctgcacgcgctacaatacatgcacatacaagctgtgtagatctcagagggttaacctaatagggtatgta |
393 |
Q |
| |
|
|| |||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35674633 |
atgctagctgcgtaaagaaagagtaggtagctgcacgcgctacaatacatgcacagacaagctgtgtagatctcagagggttaacctaatagggtctgta |
35674534 |
T |
|
| Q |
394 |
t |
394 |
Q |
| |
|
| |
|
|
| T |
35674533 |
t |
35674533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 122 - 158
Target Start/End: Complemental strand, 8342783 - 8342747
Alignment:
| Q |
122 |
aacagaacaaggcaagataaactttaatggtattgaa |
158 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
8342783 |
aacagaacaacgcaagataaacttttatggtattgaa |
8342747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University