View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9757_low_9 (Length: 361)
Name: NF9757_low_9
Description: NF9757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9757_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 18 - 354
Target Start/End: Complemental strand, 39557996 - 39557652
Alignment:
| Q |
18 |
aaatgtttggtaccaaacatatcacactttgatccaacaagtttacgaactaattcaacaaattat--------ttattgacgtaatggaaaaaacacag |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39557996 |
aaatgtttggtaccaaacatatcacactttgattcaacaagttttcgaactaattcaacaaattataagttaacttattgacgtaatggaaaaaacacag |
39557897 |
T |
|
| Q |
110 |
cctaattctcaaatgaacactcaaacatccaattctttcacacagatatagttggagaatcaaactctggatagaaaaattcaactctcataacaccatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39557896 |
cctaattctcaaatgaacactcaaacatccaattctttcacacatatatagttggagaatcaaactctggatagaaaaattcaactctcataacaccatt |
39557797 |
T |
|
| Q |
210 |
ttagtcgtataagttacggggtcggccttagcccaaggcaatagaggatagggctttagatttctatttttcttggtatttaaggtctcaactaaattta |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39557796 |
ttagtcgtataagttacggggtcggccttagcccaaggcaatagaggatagggctttagatttctatttttcttggtatttaaggtctcaactaaattta |
39557697 |
T |
|
| Q |
310 |
agttataatgataatgatatgtattatttttatcaactgagttca |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39557696 |
agttataatgataatgatatgtattatttttatcaactgaattca |
39557652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University