View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9758_high_10 (Length: 322)
Name: NF9758_high_10
Description: NF9758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9758_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 11 - 304
Target Start/End: Complemental strand, 30737616 - 30737330
Alignment:
| Q |
11 |
cacagacatgacttattatgcttgggtcaaggcataatttaacatg-atgtatataaaacatctatgatgcttcttttgtattggaggcttccaatagat |
109 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30737616 |
cacagacatgacttattatgcttgagtcaaggcataagttaacatggatgtatataaaacatctatgatacttcttttgtattggaggcttccaatagat |
30737517 |
T |
 |
| Q |
110 |
tttgtgtccttgcttcaatgatgaattcattgcatagtgtttacatcgagagatgtaagttggctcggatgtatttaaaacattcgagaccaggcatttt |
209 |
Q |
| |
|
|| ||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30737516 |
ttcgtgtccttgcttcaaggatgaattcattccatagtgtttacat--------gtaagttggctcggatgtatttaaaacattcgagaccaggcatttt |
30737425 |
T |
 |
| Q |
210 |
tctacaaatgctcgacttggtttttactgaattaaaccaatgatggggtagaggaaccttgatcttcccttcattattgaattagaggaacaatt |
304 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30737424 |
tctacaaatgctcgacttggtttttcctgaattaaaccaatgatggggtagaggaaccttgatcttcccttcattattgaattagaggaacaatt |
30737330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University