View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9758_high_13 (Length: 253)
Name: NF9758_high_13
Description: NF9758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9758_high_13 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 24 - 253
Target Start/End: Complemental strand, 39410637 - 39410406
Alignment:
| Q |
24 |
gagctgccacaactttgaaccgatggttctcttcacccgttaaggcggagcaaagaaattgtgagcaataaagtaaaagaaaagaca-gttataatgtta |
122 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||| || ||||||||||||||||| |||| ||| |||||||||||||||| |||||||||||| |
|
|
| T |
39410637 |
gagctgccacaactttgaaccgatggtccttttcacccgtcaaagcggagcaaagaaattgcgagcgatagagtaaaagaaaagacaagttataatgtta |
39410538 |
T |
|
| Q |
123 |
tatactcaaatttcgaaggagattggacatttagcaaatctgtcaaattctagtagtgaccaaaaaagtgtaaccttttttcccaagaaga-agactgaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
39410537 |
tatactcaaatttcgaaggagattggacatttagcaaatctgtcaaattctagtagtgaccaaaaaactgtaaccttttttcccaagaagagagactgat |
39410438 |
T |
|
| Q |
222 |
tttgtgtatttcaagaagcttggtttagatgc |
253 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
39410437 |
tttatgtatttcaagaagcttggtttagatgc |
39410406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University