View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9758_low_20 (Length: 298)
Name: NF9758_low_20
Description: NF9758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9758_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 60 - 223
Target Start/End: Original strand, 35776591 - 35776755
Alignment:
| Q |
60 |
agtaagaaataaatttagagagttgctttcatctctcccctacctatgtataaaaccatgcatcataaggaatttagcttttaacaataggtaaagaatg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35776591 |
agtaagaaataaatttagagagttgctttcatctctcccctacctatgtataaaaccatgcatcataaggaatttagcttttaacaataggtaaagaatg |
35776690 |
T |
|
| Q |
160 |
gacgaaagcagctatcataaatttaactaa-ttactattatgacatcaacattaatcatatatag |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35776691 |
gacgaaagcagctgtcataaatttaactaatttactattatgacatcaacattaatcatatatag |
35776755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 220 - 293
Target Start/End: Original strand, 35777568 - 35777641
Alignment:
| Q |
220 |
atagtagtacactttaccaagaggtatgatttatacttaagtttgctttggcttttttatattcaacctttgct |
293 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35777568 |
atagtagtacaatttaccaagaggtatgatttatacttaagtttgctttggcttttttatattcaacatttgct |
35777641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University