View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9758_low_29 (Length: 238)
Name: NF9758_low_29
Description: NF9758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9758_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 14295417 - 14295195
Alignment:
| Q |
1 |
tgtatccaaacagtagtcatatatttaagcttaatctacattgaaaaagtcatttgagcagtttacctcaggggtcgccccggctgcccgaacagttgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14295417 |
tgtatccaaacagtagtcatatatttaagcttaatctacattgaaaaagtcatttgagcagtttacctcaggggtcgccccggctgcccgaacagttgct |
14295318 |
T |
|
| Q |
101 |
acagctaccgatatttcagcagcagatagtggatctaaaggatggcaggtttgagctctcatcatgaccgggatacctatgaaagaaagtgattaaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14295317 |
acagctaccgatatttcagcagcagatagtggatctaaaggatggcaggtttgagctctcatcatgaccgggatacctatgaaagaaagtgattaaaaca |
14295218 |
T |
|
| Q |
201 |
gaaaacttgatagaacatattgg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14295217 |
gaaaacttgatagaacatattgg |
14295195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 64 - 153
Target Start/End: Complemental strand, 29137496 - 29137407
Alignment:
| Q |
64 |
tacctcaggggtcgccccggctgcccgaacagttgctacagctaccgatatttcagcagcagatagtggatctaaaggatggcaggtttg |
153 |
Q |
| |
|
||||||||| || || || ||||| ||||||||||| |||||||| ||||||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
29137496 |
tacctcaggtgttgctccagctgctcgaacagttgcaacagctacggatatttcagcagcagaaagtggatccaaaggatggcaagtttg |
29137407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University