View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9758_low_34 (Length: 227)
Name: NF9758_low_34
Description: NF9758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9758_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 1028287 - 1028403
Alignment:
| Q |
1 |
tacgatcgatgttagcccttggaagcaaaagctcatggtcatctttgttctcatgagttcaacgattacttcatcagtgctggctcgtaaatacaaaaga |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1028287 |
tacgatcgatgttggcccttggaagcaaaagctcatggtcatctttgttctcatgagttcaacgattacttcatcagtgctggctcgtaaatacaaaaga |
1028386 |
T |
 |
| Q |
101 |
aaattagttgacttttg |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1028387 |
aaattagttgacttttg |
1028403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 115 - 194
Target Start/End: Original strand, 1033609 - 1033688
Alignment:
| Q |
115 |
ttggtgattgctggcagttgctgcttccaaattctgcttcatttctatgggaaggtctgtgtagaagacgttcattggaa |
194 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
1033609 |
ttggtgattcctggcagttgctgcttccaaattctgcttcatttctgtgggaagatcttggtagaagacgttcattggaa |
1033688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 115 - 193
Target Start/End: Original strand, 4516149 - 4516227
Alignment:
| Q |
115 |
ttggtgattgctggcagttgctgcttccaaattctgcttcatttctatgggaaggtctgtgtagaagacgttcattgga |
193 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
4516149 |
ttggtgattcctggcagctgctgcttccaaattctgcttcatttctgtgggaagatcttggtagaagacgttcattgga |
4516227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 117 - 227
Target Start/End: Complemental strand, 50832502 - 50832396
Alignment:
| Q |
117 |
ggtgattgctggcagttgctgcttccaaatt---ctgcttcatttctatgggaaggtctgtgtagaagacgttcattggaagttggaactcttggtagat |
213 |
Q |
| |
|
||||||| |||||||||||||||||| |||| ||||||||||||| ||||||| ||| |||| ||||||| | |||||||||||||||||| |
|
|
| T |
50832502 |
ggtgattcctggcagttgctgcttccgaattccgctgcttcatttctgtgggaagatcttggtaggagacgttta-------ttggaactcttggtagat |
50832410 |
T |
 |
| Q |
214 |
ggaactgacccaat |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
50832409 |
ggaactgacccaat |
50832396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University