View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9758_low_35 (Length: 227)
Name: NF9758_low_35
Description: NF9758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9758_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 214
Target Start/End: Complemental strand, 46747784 - 46747579
Alignment:
| Q |
9 |
gagcagagagagaaaaacatgaactcaccacccatgtgttgttctcagcattataagtctctccactgttgggatatacaagtattggtttacttgttac |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46747784 |
gagctgagagagaaaaacatgaactcaccacccatgtgttgttctcagcattataagtctctccactgttgggatatacaagtattggtttacttgttac |
46747685 |
T |
 |
| Q |
109 |
ctgatatttaagaaatcaatgaacaagtatcagctttatcactatttttagttgaaaattgtgcatattgaacaaaaatgttgatagtataataccaaga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46747684 |
ctgatatttaagaaatcaatgaacaagtatcagctttatcactatttttagttgaaaattgtgcatattgaacaaaaatgttgatagtataataccaaga |
46747585 |
T |
 |
| Q |
209 |
aactat |
214 |
Q |
| |
|
|||||| |
|
|
| T |
46747584 |
aactat |
46747579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University