View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9758_low_41 (Length: 203)
Name: NF9758_low_41
Description: NF9758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9758_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 26 - 186
Target Start/End: Original strand, 48526791 - 48526951
Alignment:
| Q |
26 |
ataccaattttgctttgttgaggagacgacgagcatatttacgatcagtatgtctaaaaacaatggaagaagaagccatagctgcagccgtttcagaagc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48526791 |
ataccaattttgctttgttgaggagacgacgagcatatttacgatcagtatgtctaaaaacaatggaagaagaagccatagctgcagccgtttcagaagc |
48526890 |
T |
|
| Q |
126 |
aatctcactaccgggtgtgttactatcaatgactttaaccgatctttttgtcttcattttt |
186 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48526891 |
aatctcactaccaggtgtgttactatcaatgactttaaccgatctttttgtcttcattttt |
48526951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 25 - 182
Target Start/End: Original strand, 7222175 - 7222332
Alignment:
| Q |
25 |
cataccaattttgctttgttgaggagacgacgagcatatttacgatcagtatgtctaaaaacaatggaagaagaagccatagctgcagccgtttcagaag |
124 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||| |||||| ||||| ||| ||||||||||||||||||| ||||||||| |||| ||||||| | |
|
|
| T |
7222175 |
cataccaattttgctttattgaggagacggcgagaatatttgggatcaacatgcctaaaaacaatggaagaagcagccatagcagcagaagtttcagctg |
7222274 |
T |
|
| Q |
125 |
caatctcactaccgggtgtgttactatcaatgactttaaccgatctttttgtcttcat |
182 |
Q |
| |
|
|||||||| | || ||||||||||||||||| | |||||| | ||| ||||||||||| |
|
|
| T |
7222275 |
caatctcagtgccaggtgtgttactatcaattaatttaactgttctctttgtcttcat |
7222332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 60; Significance: 8e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 32 - 155
Target Start/End: Complemental strand, 50305553 - 50305430
Alignment:
| Q |
32 |
attttgctttgttgaggagacgacgagcatatttacgatcagtatgtctaaaaacaatggaagaagaagccatagctgcagccgtttcagaagcaatctc |
131 |
Q |
| |
|
|||||||||| || |||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||| | |||| ||||||| ||||||| |
|
|
| T |
50305553 |
attttgctttattaaggagatgacgagcatatttacgatcaacatgtctaaaaacaatggaagaagtagccataacagcagaagtttcagctgcaatctt |
50305454 |
T |
|
| Q |
132 |
actaccgggtgtgttactatcaat |
155 |
Q |
| |
|
| ||||||||||||||| ||||| |
|
|
| T |
50305453 |
aaaaccgggtgtgttactgtcaat |
50305430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University