View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9758_low_8 (Length: 415)
Name: NF9758_low_8
Description: NF9758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9758_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 8e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 19 - 183
Target Start/End: Original strand, 33525321 - 33525485
Alignment:
| Q |
19 |
ggaagagatagagaaaattcataacaacaagaagcnnnnnnngcgtctcaattgggccgaatctctcggtttcaagaaagagattatgcaattcttcact |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525321 |
ggaagagatagagaaaattcataacgacaagaagcaaaaaaagcgtctcaattgggccgaatctctcggtttcaagaaagagattatgcaattcttcact |
33525420 |
T |
|
| Q |
119 |
tgtttacgagccatacgctttgaccttcgttgctttggatccttctctggaaccgatatctcaac |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33525421 |
tgtttacgagccatacgctttgaccttcgttgctttggatccttctctggaaccgatatcacaac |
33525485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 240 - 329
Target Start/End: Original strand, 33525542 - 33525631
Alignment:
| Q |
240 |
tgtattataacgatcatgttggtgtagaagagactcatcgtgacagcgaatcatcaagagctgtgttctcaaaatggttcatggttatgc |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33525542 |
tgtattataacgatcatgttggtgtagaagagactcatcgcgacagcgaatcatcaagagctgtgttctcaaaatggttcatggtgatgc |
33525631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University