View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9758_low_9 (Length: 379)
Name: NF9758_low_9
Description: NF9758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9758_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 20 - 375
Target Start/End: Complemental strand, 36591245 - 36590890
Alignment:
| Q |
20 |
ttaccaacttcaaaataatgttcttaatcttataataacgtacacctaacaaaattctatatatatagctcaactcttgactctctcattgtacaattca |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36591245 |
ttaccaacttcaaaataatgatcttaatcttataataacgtacacctaacaaaattctatatatatagctcaactcttgactctcttattgtacaattca |
36591146 |
T |
 |
| Q |
120 |
ttttcccaaccaatataaccttttcagtcccattttctattagagtgacataacataagatattttgtggaaatggcaacatttggtgcctctgcatttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36591145 |
ttttcccaaccaatataaccttttcagtcccattttctattagagtgacataacataagatattttgtggaaatggcaacatttggtgcctctgcatttc |
36591046 |
T |
 |
| Q |
220 |
agtttttaatgttgataatggttataggcttgttttgcgtgacaaacattgttgcacaagattcagagatcgcacccacatcacaattggagactggaac |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36591045 |
agtttttaatgttgataatggttataggcttgttttgcgtgacaaacattgttgcacaagattcggagatcgcacccacatcacaattggagactggaac |
36590946 |
T |
 |
| Q |
320 |
tggatttgctttgcctatttctgggatgatcatgttttcttctctctctgcttctc |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
36590945 |
tggatttgctttgcctatttctgggatgataatgttttcttctctctttgcttctc |
36590890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University