View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9759_low_11 (Length: 372)
Name: NF9759_low_11
Description: NF9759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9759_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 187 - 356
Target Start/End: Complemental strand, 25118271 - 25118102
Alignment:
| Q |
187 |
ataatatactcttttatggcaccaatcttcctagtcataagttttaatgacaataaactttttgataacaaaagaaatcttctaaatacatactactaca |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25118271 |
ataatatactcttttatggcaccaatcttcctagtcattggttttaatgacaataaacttttcgataacaaaagaaatcttctaaatacatactactaca |
25118172 |
T |
|
| Q |
287 |
aaataacttccttaagtatatggttaaaaacatgtttaataatctcaagcaggaagcaacacaaaagtat |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25118171 |
gaataacttccttaagtatatggttaaaaacatgtttaataatctcaagcaggaagcaacacaaaagtat |
25118102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 196 - 224
Target Start/End: Complemental strand, 25118332 - 25118304
Alignment:
| Q |
196 |
tcttttatggcaccaatcttcctagtcat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25118332 |
tcttttatggcaccaatcttcctagtcat |
25118304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University