View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9759_low_19 (Length: 270)
Name: NF9759_low_19
Description: NF9759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9759_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 8 - 252
Target Start/End: Original strand, 12498773 - 12499014
Alignment:
| Q |
8 |
acgttggagacaaacttaaatctaccttatgtaccccaattctatcggttggtattgatatgtaaactcatagaaacatagattagacaccattctttca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
12498773 |
acgttggagacaaacttaaatctaccttacgtatcccaattctatcggttggtattgaaatgtaaactcataaaaacatagattagccaccattctttca |
12498872 |
T |
 |
| Q |
108 |
caataacacattcacactcctctnnnnnnnnnnttacacatcacacacactcataaacaaattttgttggtttcatctttgtttcactatggtttcacaa |
207 |
Q |
| |
|
||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
12498873 |
caaaaacacattcacactcctct--aaaaaaaattacacatcacacacactcataaacaaattttgttggtttcatctttgtttcactatggtttcataa |
12498970 |
T |
 |
| Q |
208 |
tatgactgactcttatacccctttattatctttctttcacttgat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
12498971 |
tatgactgactcttatacccctttattat-tttttttcacttgat |
12499014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University