View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9759_low_25 (Length: 252)
Name: NF9759_low_25
Description: NF9759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9759_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 13134819 - 13134993
Alignment:
| Q |
1 |
gaaggggcaaagtttaacggtgttgatgcctggggatgaggtaccaaagtttatagccatgccttgcccgtgtcagcattcgcggctagaagagattatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13134819 |
gaaggggcaaagtttaacggtgttgatgcctggggatgaggtaccaaagtttatagccatgccttgcccgtgtcagcattcgcggctagaagagattatt |
13134918 |
T |
|
| Q |
101 |
gtcaacatcgagaagccatcgtccaaaccaccatgaccaccaccgtagcatgttaattaacttgccgtgtgcata |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13134919 |
gtcaacatcgagaagccatcgtccaaaccaccatgaccaccaccgtagcatgttaattaacttgccgtgtgcata |
13134993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 13134986 - 13135033
Alignment:
| Q |
186 |
tgtgcatatgcattttgccatcaattgttgtttgtattcatacatgtcttg |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13134986 |
tgtgcatatgcattttgccatcaa---ttgtttgtattcatacatgtcttg |
13135033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 30252224 - 30252063
Alignment:
| Q |
1 |
gaaggggcaaagtttaacggtgttgatgcctggggatgaggtaccaaagtttatagccatgc---cttgcccgtgtcagcattcgcggctagaagagatt |
97 |
Q |
| |
|
||||||||| ||| | |||||||||||| | |||||||||||||| |||||||||||||||| |||||||||||| |||||||| ||||||||||||| |
|
|
| T |
30252224 |
gaaggggcagagtgtgacggtgttgatgtcaggggatgaggtaccgaagtttatagccatgctgccttgcccgtgtcggcattcgcagctagaagagatt |
30252125 |
T |
|
| Q |
98 |
attgtcaacatcgagaagccatcgtccaaaccaccatgaccaccaccgtagcatgttaatta |
159 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| ||| ||||| |||| |||||||||| |
|
|
| T |
30252124 |
attgtcaacatcgagaagccaccgaccaaaccacggtgatcaccattgtagtatgttaatta |
30252063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University