View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9759_low_36 (Length: 226)
Name: NF9759_low_36
Description: NF9759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9759_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 53 - 209
Target Start/End: Complemental strand, 24942901 - 24942745
Alignment:
| Q |
53 |
cagggaatgaatcttgccccaactcaaaacattgtcaatcaccttcgacaaattcatcatttttcttttgaagagtatatcatttatttccagccgaata |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| || ||||||| |
|
|
| T |
24942901 |
cagggaatgaatcttgccccaactcaaaacattgtcaatcaccttcgacaaatttatcatttttcctttgaagagtatatcatttattttcatccgaata |
24942802 |
T |
 |
| Q |
153 |
gaccaagttgctaccaaccatatgatatgaatttcttcgcattttttcctttcacca |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
24942801 |
gaccaagttgctaccaaccatatgagatgaatttcttcacattttttcctttcacca |
24942745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University