View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9761_low_3 (Length: 249)
Name: NF9761_low_3
Description: NF9761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9761_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 46730646 - 46730408
Alignment:
| Q |
1 |
tatgcttactagttttgaatgagacacagcgttaaatttgtaatctgaagtaatttaatattctgtatgacttgtgatgaagtttattgatatgtctaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46730646 |
tatgcttactagttttgaatgagacacagcgttaaatttgtaatctgaagtaatttaatattctgcatgacttgtgatgaagtttattgatatgtctaca |
46730547 |
T |
 |
| Q |
101 |
ttattaattagtttattgcctaaattttccgtgcaatgtattcttttctatatttggttaggtaggggaaactaccggcaacattgaagaaagctgtgta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46730546 |
ttattaattagtttattgcctaaattttccgtgcaatgtattcttttctatatttggttaggtaggggaaactactggcaacattgaagaaagctgtgta |
46730447 |
T |
 |
| Q |
201 |
acctttgcaactcgtgccttgggattgacaacccctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46730446 |
acctttgcaactcgtgccttgggattgacaacccctttg |
46730408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 179 - 239
Target Start/End: Complemental strand, 7926623 - 7926563
Alignment:
| Q |
179 |
caacattgaagaaagctgtgtaacctttgcaactcgtgccttgggattgacaacccctttg |
239 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7926623 |
caacattgaagaaagttgtgcaacctttgcaactcgtgccttgggattgacaacacctttg |
7926563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University