View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9761_low_4 (Length: 243)
Name: NF9761_low_4
Description: NF9761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9761_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 47706073 - 47705858
Alignment:
| Q |
18 |
gaagagattcaaagtttggacttacaaagaaggtgaaccaccattagtccatgatggacccatgagttcaatttacggcatcgagggacatttcatgact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47706073 |
gaagagattcaaagtttggacttacaaagaaggtgaaccaccattagtccatgatggacccatgagttcaatttacggcatcgagggacatttcatgact |
47705974 |
T |
|
| Q |
118 |
gaaattgagaatagattgagtccattttcaacccacaatccagatgaggctcatgtctttatgctacccttaagtgttacaaacatggtgcactacctat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705973 |
gaaattgagaatagattgagtccattttcgacccacaatccagatgaggctcatgtctttatgctacccttaagtgttacaaacatggtgcactacctat |
47705874 |
T |
|
| Q |
218 |
acaatcctctcaccac |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
47705873 |
acaatcctctcaccac |
47705858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University