View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9762_high_7 (Length: 262)
Name: NF9762_high_7
Description: NF9762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9762_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 12 - 159
Target Start/End: Original strand, 41170002 - 41170149
Alignment:
| Q |
12 |
tgaggaaattcgatgcatggccagttttcttcaagagagaatggaacaggaattggcctttcttggttggattcgctgtaactggagctctagtcaccaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41170002 |
tgaggaaattcgatgcatggccagttttcttcaagagagaatggaacaggaattggcctttcttggttggattcgctgtaactggagctctagtcaccaa |
41170101 |
T |
 |
| Q |
112 |
gttttctcttggtctcagtggtaaatttattacttcattttcaaatca |
159 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41170102 |
gttttcccttggtctcagtggtaaatttattacttcattttcaaatca |
41170149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 205 - 262
Target Start/End: Original strand, 41170192 - 41170249
Alignment:
| Q |
205 |
gcagaggaagatgccaaaaactccaaattcgttcaagcacataagaggtaacacttca |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41170192 |
gcagaggaagatgccaaaaactccaaattcgttcaagcacataagaggtaacacttca |
41170249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 126
Target Start/End: Original strand, 23334882 - 23334988
Alignment:
| Q |
20 |
ttcgatgcatggccagttttcttcaagagagaatggaacaggaattggcctttcttggttggattcgctgtaactggagctctagtcaccaagttttctc |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| | | |||||| ||| | ||||||||||| || || |||||||| |||||||| || |||| |
|
|
| T |
23334882 |
ttcgatccatggccagttttcttcaagagagaatggaaacgtacttggccattcctcgttggattcgccgtcaccggagctcttgtcaccaaattctctc |
23334981 |
T |
 |
| Q |
120 |
ttggtct |
126 |
Q |
| |
|
||||||| |
|
|
| T |
23334982 |
ttggtct |
23334988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University