View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9762_low_22 (Length: 224)
Name: NF9762_low_22
Description: NF9762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9762_low_22 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 101 - 224
Target Start/End: Original strand, 45524457 - 45524580
Alignment:
| Q |
101 |
aagaaataaatagccatgatttaataaatgaattatgaaaaatttgtattaactatgtatgaacaagtgaaatgcaggttatctaaatgatctggaggca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45524457 |
aagaaataaatagccatgatttaataaatgaattatgaaaaatttgtattaactatgtatgaacaagtgaaatgcaggttatctaaatgatctggaggca |
45524556 |
T |
|
| Q |
201 |
acagagagaaccatagacaaagaa |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45524557 |
acagagagaaccatagacaaagaa |
45524580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 45524334 - 45524407
Alignment:
| Q |
1 |
aagtgtcatctcttcattcatgggatgtctttgactccaaacaaaacaattcagctccactttcatataccaat |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45524334 |
aagtgtcatctcttcattcatgggatgtctttgactccaaacaaaacaattcagctccactttcatataccaat |
45524407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University