View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9762_low_23 (Length: 207)
Name: NF9762_low_23
Description: NF9762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9762_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 13 - 147
Target Start/End: Original strand, 43274974 - 43275108
Alignment:
| Q |
13 |
cataggaatgaacataaaataaaacgttaactttagtttgtaaaacattactctctccaatttaatctattttaggaactgaaccaaaaatatacatatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43274974 |
cataggaatgaacataaaataaaacgttaactttagtttgtaaaacattactctctccaatttaatctattttaggaactgaaccaaaaatatacatatt |
43275073 |
T |
 |
| Q |
113 |
tattgactaaattaatgatttattcaatatataaa |
147 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
43275074 |
tattgactaaattaataatttattcaatatataaa |
43275108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University