View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9763_high_11 (Length: 309)
Name: NF9763_high_11
Description: NF9763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9763_high_11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 9 - 309
Target Start/End: Complemental strand, 35074164 - 35073885
Alignment:
| Q |
9 |
agcataggtgaacaacatttaccacattttacactttgaattttatagctggttgattcaatacaataccattcaaaattcaggaatttcaacaaaaaat |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074164 |
agcaaaggtgaacaacatttaccacattttacactgtgaattttatagctggttgattcaatacaataccattcaaaattcaggaatttcaacaaaaaat |
35074065 |
T |
 |
| Q |
109 |
aaatcaatgcaccaagccacagcagaacaaattgggaagacaaattatgcaacaaaaattagtggtgccggagtaactaccacctaaatcctgaggagtg |
208 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074064 |
aagtcaatgcaccaagccacagcagaacaaattgggaagacaaattatgcaacaaaaattagtggtgccggagtaactaccacctaa------------- |
35073978 |
T |
 |
| Q |
209 |
ttgcccaccaagtgggatttttagcggctttagggagaaccgaagccgcatctatggggatatgggagattaattttggaccgtcgttgaccagctaggt |
308 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35073977 |
--------taagtgggatttttagtggctttagggagaaccgaagccgcatctatggggatatgggagattaattttggaccgtcgttgaccagctaggt |
35073886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University