View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9763_high_2 (Length: 431)
Name: NF9763_high_2
Description: NF9763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9763_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 8e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 148 - 318
Target Start/End: Original strand, 9520966 - 9521136
Alignment:
| Q |
148 |
tgcttatatttttatttgaaaacttgatttaagtcaataattgcttatgaattaagttgtaatatttactttgcgtttagaaatgttgctaggttgtttt |
247 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||| | ||||| |||||||||||| |
|
|
| T |
9520966 |
tgcttatctttttatttgagaacttgatttaagttaataattgcttatgtattaagttgtaatatttactttgtgtttaaacatgttactaggttgtttt |
9521065 |
T |
|
| Q |
248 |
tacaaatttgaatgtattattaattatgggattcttttgttttaacctcttgatggatgttcaatctgatg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9521066 |
aacaaatttgaatgtattattaattatgggattcttttgttttaacctcttgatggatgttcaatatgatg |
9521136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 17 - 82
Target Start/End: Original strand, 9520901 - 9520966
Alignment:
| Q |
17 |
aaatattggggtgaaccaggttcccttagcaccaggtggagggaatcaatgatattgcagggtcat |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
9520901 |
aaatattggggtgaaccaggttcccttagtaccaggtggtgggaatcaatgatattgcaaggtcat |
9520966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University