View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9763_high_22 (Length: 234)
Name: NF9763_high_22
Description: NF9763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9763_high_22 |
 |  |
|
| [»] scaffold0856 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0856 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 4518 - 4303
Alignment:
| Q |
1 |
tagaatcttaattagaaatatgtcctagcctacaatggatgcagattgacaaagaatcggttcggcagtgggttgagttgaaacatgatttgtatttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4518 |
tagaatcttaattagaaatatgtcctagcctacaatggatgcagattgacaaagaaccggttcggcagtgggttgagttgaaacatgatttgtatttgat |
4419 |
T |
 |
| Q |
101 |
gatcatgaatccaagtgtagatgaattgtatacttaacctactacctggtcagttatctctttcaccatccgacaattgagtcaacatgtctccaaacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4418 |
gatcatgaatccaagtgtagatgaattgtatacttaacctactacctggtcagttatctctttcaccatccgacaattgagtcaacatgtctccaaacct |
4319 |
T |
 |
| Q |
201 |
caaccaacaagttcat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4318 |
caaccaacaagttcat |
4303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University