View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9763_high_9 (Length: 315)
Name: NF9763_high_9
Description: NF9763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9763_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 19 - 303
Target Start/End: Original strand, 34375368 - 34375653
Alignment:
| Q |
19 |
ccaaggacattgatccaacgtgtaatgaatccacaaaatagaaaaatagcaagaagagtgtgtgggataaagatgatggtgaaacatcacaaaccatgtg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34375368 |
ccaaggacattgatccaacgtgtaatgaatccacaaaatagaaaaatagaaagaagagtgtgtgggataaagatgatggtgaaacatcaaaaaccatgtg |
34375467 |
T |
 |
| Q |
119 |
gcctgtgggggagtgggaatcagaattggttatagtataaaggaaagtaagacagaaaaaattgtctttttcgatgtgtaatagtaatactatagtaact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34375468 |
gcctgtgggggagtgggaatcagaattggttatagtataaaggaaagtaagacagaaaaaattgtctttttcgatgtgtaatagtaatactatagtaact |
34375567 |
T |
 |
| Q |
219 |
actatacaagtaatattattatgtttattaactttttcctacaaccaccgttacaggcaagaagat-aaggataccgtcacaggtt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
34375568 |
actatacaagtaatattattatgtttattaactttttcctacaaccaccgttacaggcaagaagataaaggatatcgtcacaggtt |
34375653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University