View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9763_low_12 (Length: 312)
Name: NF9763_low_12
Description: NF9763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9763_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 18 - 288
Target Start/End: Complemental strand, 13879675 - 13879405
Alignment:
| Q |
18 |
gatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879675 |
gatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattg |
13879576 |
T |
|
| Q |
118 |
atgtctgtgttgatcacggtactctcaggattgaggatgttcttcccggtcgaaatctgttttcagtaacacttaacttgaaagggaagcactgcgactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879575 |
atgtctgtgttgatcacggtactctcaggattgaggatgttcttcccggtcgaaatctgttttcagtaacacttaacttgaaagggaagcactgcgactt |
13879476 |
T |
|
| Q |
218 |
tgttaacactaaagccaaaatgatagagaacaatttcattgaagttgtggttcctaagctcaagaacaagg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879475 |
tgttaacactaaagccaaaatgatagagaacaatttcattgaagttgtggttcctaagctcaagaacaagg |
13879405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 28 - 288
Target Start/End: Complemental strand, 13875448 - 13875188
Alignment:
| Q |
28 |
atcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattgatgtctgtgt |
127 |
Q |
| |
|
||||||||||||| |||||| |||||| ||||||||| ||||||| |||| |||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13875448 |
atcttgttctctgtgattttgaggagaccgaggagtctttgatttttcggttgaatctggtcgccaacaacgtgaggaaggaagagattgatgtctgtgt |
13875349 |
T |
|
| Q |
128 |
tgatcacggtactctcaggattgaggatgttcttcccggtcgaaatctgttttcagtaacacttaacttgaaagggaagcactgcgactttgttaacact |
227 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||| |||||||||| ||||||| ||||| |||||||||||||||| | |||| ||||||||||| |
|
|
| T |
13875348 |
tgatcacggtactctcaggattaaggatgctcttccaggtcgaaatcgattttcaggtacactcgacttgaaagggaagcatttcgacgttgttaacact |
13875249 |
T |
|
| Q |
228 |
aaagccaaaatgatagagaacaatttcattgaagttgtggttcctaagctcaagaacaagg |
288 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||| |||||||| ||||||| |
|
|
| T |
13875248 |
aaagccaaaatgatagagaacaatttccttgaaattgtggttcccaagctcaacaacaagg |
13875188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University