View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9763_low_21 (Length: 240)
Name: NF9763_low_21
Description: NF9763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9763_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 223
Target Start/End: Complemental strand, 49974764 - 49974548
Alignment:
| Q |
9 |
ctttgaaatttggtatatctcatagatgacatatacatagtccttttcaaaaaa--tatacattgatcagagaaacggatttgaatttcattattatttc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49974764 |
ctttgaaatttggtatatctcatagatgacatatacatagtccttttcaaaaaaattatacattgatcagagaaacggatttgaatttcattattatttc |
49974665 |
T |
|
| Q |
107 |
attctctgtcattacttgatatatgcttagatgtatttctcgcaaagaatcgacctctaatgactactttatatggttgcttagtgttatccgtatatat |
206 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49974664 |
attctctgtcattacttgatatatgctgagatgtatttctcgcaaagaatcgacctctaatgactactttatatggttgcttagtgttatccgtatatat |
49974565 |
T |
|
| Q |
207 |
atgcagattgcagaagc |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
49974564 |
atgcagattgcagaagc |
49974548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University