View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9763_low_6 (Length: 358)
Name: NF9763_low_6
Description: NF9763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9763_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 272 - 335
Target Start/End: Original strand, 11247333 - 11247396
Alignment:
| Q |
272 |
tttatgagcattgtcatgctcaatttatttctttgcatttggttgatctgttgggagttgccat |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11247333 |
tttatgagcattgtcatgctcaatttatttctttgcatttggttgatttgttgggagttgccat |
11247396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University