View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9764_high_3 (Length: 273)
Name: NF9764_high_3
Description: NF9764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9764_high_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 7 - 273
Target Start/End: Complemental strand, 7109049 - 7108783
Alignment:
| Q |
7 |
atttctaatcatcaaagaggatttattcaacaaagacaaatcaaagagtgtatcaacctcacttgagaggcaaccgatcttctccataatagatcttttg |
106 |
Q |
| |
|
|||||||| || ||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
7109049 |
atttctaagcagcaaagagaatttattcaacacagacaaatcaaagagtgcatcaacctcacttgagaggcacccgatcttcgccataatagatcttttg |
7108950 |
T |
 |
| Q |
107 |
gaggtaatcttgcccttaaaatagacatttataaagcttttgacactgtggaatgaaaatttcttttgaagattttgaaagcttttggttttaatgaaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108949 |
gaggtaatcttgcccttaaaatagacatttataaagcttttgacactgtggaatgaaaatttcttttgaagattttgaaagcttttggttttaatgaaaa |
7108850 |
T |
 |
| Q |
207 |
catttgtaattggatagaggtcattttaaactcatattctctgataatttctctcaatgataagctt |
273 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7108849 |
catttggaattggatagaggtcattttaaactcatattgtctgataatttctctcaatgataagctt |
7108783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University