View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9764_high_5 (Length: 239)
Name: NF9764_high_5
Description: NF9764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9764_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 76 - 224
Target Start/End: Original strand, 8359904 - 8360052
Alignment:
| Q |
76 |
agataactcttgaaggttgtttcttaggataaggaacaaatagggagtcaaataaacaaccatcctctatgtgatcagaggcggccctggacatagctcc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
8359904 |
agataactcttgaaggttgtttcttaggataaggaacaaatagggagtcaaataaacaaccatcctctatgtgataagaggcggccctggacataggtcc |
8360003 |
T |
 |
| Q |
176 |
aaggtgcgacggcctagaacccatgtttgtaggggcccacatatttttt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8360004 |
aaggtgcgacggcctagaacccatgtttgtaggggcccaaatatttttt |
8360052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 8359785 - 8359868
Alignment:
| Q |
1 |
tatttgaaagttgctctttacaactccatgttgatgattgcccttttga-ccccacaaatatgcaaaccgttcaggagataact |
83 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
8359785 |
tatttgaaagtttctctttacaactccatgttgatgattgcccttttgacccccacaaatgtgcaaaccgttcaggagataact |
8359868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University