View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9764_low_10 (Length: 249)
Name: NF9764_low_10
Description: NF9764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9764_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 24959514 - 24959276
Alignment:
| Q |
1 |
aattcctacatttt-ctcgcaacatgaattaattgcaacatcgagcctctttcaaaaggtgaatgtttttctgacctccttatttgctcaacctattggg |
99 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24959514 |
aattcctacatttttctcgcaacatgaattaattgcaacatcgagcctcttctaaaaggtgaatgtttttttgacctccttatttgctcaacctattggg |
24959415 |
T |
|
| Q |
100 |
acgtaactcccgatagacnnnnnnnnnncttttccttaaaggtaaattaggagttaaatcctgatggggctattgaaggatttgtaggccttagttgtgg |
199 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24959414 |
acgtaactcccgatagactttttttttt-ttttgcttaaaggtaaattaggagttaaatcccgatggagctattgaaggatttgtaggccttagttgtgg |
24959316 |
T |
|
| Q |
200 |
gtggaccgtggtaggtccaaggagtgaagaatgtggccctatg |
242 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||| |
|
|
| T |
24959315 |
gtggactgtggtaggtcca---agtgaagaatgtggcgctatg |
24959276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 24954986 - 24954869
Alignment:
| Q |
1 |
aattcctacattttctcgcaacatgaat-taattgcaacatcgagcctctttcaaaaggtgaatg-tttttctgacctccttatttgctcaacctattgg |
98 |
Q |
| |
|
||||||||| |||||| |||||||||| ||||||||||| |||||| ||||||||||||||||| ||| || |||||||||||||||| ||||||| |
|
|
| T |
24954986 |
aattcctacgttttcttgcaacatgaaagtaattgcaacaacgagcccctttcaaaaggtgaatgcactttttggtctccttatttgctcaatctattgg |
24954887 |
T |
|
| Q |
99 |
gacgtaactcccgataga |
116 |
Q |
| |
|
|| |||| || ||||||| |
|
|
| T |
24954886 |
gatgtaattcacgataga |
24954869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 161 - 242
Target Start/End: Complemental strand, 24954797 - 24954716
Alignment:
| Q |
161 |
tgatggggctattgaaggatttgtaggccttagttgtgggtggaccgtggtaggtccaaggagtgaagaatgtggccctatg |
242 |
Q |
| |
|
||||||||||||||||| |||| |||||| | |||||| |||||||||| ||||| |||||||||||||||| || ||||| |
|
|
| T |
24954797 |
tgatggggctattgaagaatttccaggcctaaattgtggatggaccgtggcaggtctaaggagtgaagaatgttgcactatg |
24954716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University