View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9764_low_3 (Length: 412)
Name: NF9764_low_3
Description: NF9764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9764_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 6e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 125 - 299
Target Start/End: Original strand, 8316816 - 8316988
Alignment:
| Q |
125 |
tgatcaataacaagcgtgatgtatcccttcaaaatacttggatctctagcatatcttgaatcagagagtaaaaagtgttcgaatccattcttctttttat |
224 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||||||||||| | |||| |||||||| ||||||||| |
|
|
| T |
8316816 |
tgatcaataacaagcgtgatatatcccttcaaaatacttggatctctagcat--cttgaatcggagagtaaaaattcttcggatccattcatctttttat |
8316913 |
T |
 |
| Q |
225 |
aaactccccttctctgttctttcatcttattatcttttcaaatccccctcattggaagaattagaattggtactc |
299 |
Q |
| |
|
| |||||||| |||| |||| ||||| ||||||||||||| | | |||| || ||||||||||||||||||||| |
|
|
| T |
8316914 |
cagctccccttttctgctcttacatctcattatcttttcaactgcacctccttagaagaattagaattggtactc |
8316988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 365 - 400
Target Start/End: Complemental strand, 8359131 - 8359096
Alignment:
| Q |
365 |
ttttactattgatccctccaatgagtgtatgatcct |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8359131 |
ttttactattgatccctccaatgagtgtatgatcct |
8359096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 28111759 - 28111707
Alignment:
| Q |
124 |
gtgatcaataacaagcgtgatgtatcccttcaaaatacttggatctctagcat |
176 |
Q |
| |
|
|||||| ||||||| ||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
28111759 |
gtgatctataacaaacgttgtgtatcacttcaaaatacatggatctctagcat |
28111707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University