View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9764_low_7 (Length: 328)
Name: NF9764_low_7
Description: NF9764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9764_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 8e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 92 - 311
Target Start/End: Original strand, 43996611 - 43996824
Alignment:
| Q |
92 |
aaagtgagttgagagtgattaagcatttgataggaataaaatgattgtttgannnnnnnnaacatattattgtactgtactaggtgttgaaaccatcact |
191 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43996611 |
aaagtgagttgagagtgattaagtatttgataggaataaaatgtttgtttgattttttttaacatattattgtactgtactaggtgttgaaaccatcact |
43996710 |
T |
 |
| Q |
192 |
gacacaaggttgaagatgaacagtgttgtttgaaaattatcaattgtgttcttatattctcttacttattcaaattagtcgttgtttaaagttacttggt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
43996711 |
gacacaaggttgaagatgaacagtgttgtttgaaaattatcaattgtgttcttatattctcttacttattcaatttagtcgttgt------ttacttggt |
43996804 |
T |
 |
| Q |
292 |
tgcattataacccatgactt |
311 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43996805 |
tgcattataacccatgactt |
43996824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University