View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9765_high_3 (Length: 255)
Name: NF9765_high_3
Description: NF9765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9765_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 43780145 - 43779924
Alignment:
| Q |
11 |
cacagaaacacagttaaagatctcacgtccaaaccggatcacttagtggctgagcacggctatttttgtcaaactctggatactgcagtaacggaggcat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43780145 |
cacagaaacacagttaaagatctcacgtccaaaccggatcacttagtggctgagcacggctatttttgtcaaactctggatactgcagtaacggaggcat |
43780046 |
T |
 |
| Q |
111 |
tatgacttcagactctgtatatatctcacattccattgcctgcatgtcagatgacatattcgaaggatctttaggtgattcaggctgctttnnnnnnnca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43780045 |
tatgacttcagactctgtatatatctcacattccattgcctgcatgtcagatgacatattcgaaggatctttaggtgattcaggctgcttgcaaaaaaca |
43779946 |
T |
 |
| Q |
211 |
ttttcgttctcaaggattggca |
232 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
43779945 |
ttttcattctcaaggattggca |
43779924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University