View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9765_high_3 (Length: 255)

Name: NF9765_high_3
Description: NF9765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9765_high_3
NF9765_high_3
[»] chr3 (1 HSPs)
chr3 (11-232)||(43779924-43780145)


Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 43780145 - 43779924
Alignment:
11 cacagaaacacagttaaagatctcacgtccaaaccggatcacttagtggctgagcacggctatttttgtcaaactctggatactgcagtaacggaggcat 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43780145 cacagaaacacagttaaagatctcacgtccaaaccggatcacttagtggctgagcacggctatttttgtcaaactctggatactgcagtaacggaggcat 43780046  T
111 tatgacttcagactctgtatatatctcacattccattgcctgcatgtcagatgacatattcgaaggatctttaggtgattcaggctgctttnnnnnnnca 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||    
43780045 tatgacttcagactctgtatatatctcacattccattgcctgcatgtcagatgacatattcgaaggatctttaggtgattcaggctgcttgcaaaaaaca 43779946  T
211 ttttcgttctcaaggattggca 232  Q
    ||||| ||||||||||||||||    
43779945 ttttcattctcaaggattggca 43779924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University