View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9765_high_4 (Length: 250)
Name: NF9765_high_4
Description: NF9765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9765_high_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 6 - 250
Target Start/End: Original strand, 51114426 - 51114680
Alignment:
| Q |
6 |
gtttggtgttaatattattctagtacaaatttaattcttgattatctctttcnnnnnnnagatatctgagaaaatattctgctaattattcatgtccatt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51114426 |
gtttggtgttaatattattctagtacaaatttaattcttgattatctctttctttttttagatatctgagaaaatattctgcaaattattcatgtccatt |
51114525 |
T |
 |
| Q |
106 |
ggtgtttgaaccttatttatgtgttggattagaagttagatagaatgcatgcttgaaa----------tgtagttcatttcacacggcaaataaggtaca |
195 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
51114526 |
ggtgtttgaaccttatttatttgttggattagaagttagatagaatgcatgcttgaaatgtgtatgtctgtagttcatttcacacggcaaataagataca |
51114625 |
T |
 |
| Q |
196 |
aaacaaaatgaaacctacattaaaatgtgacatcggagtgtgttcttctcaagtc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51114626 |
aaacaaaatgaaacctacattaaaatgtgacatcggagtgtgttcttctcaagtc |
51114680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 6 - 57
Target Start/End: Complemental strand, 552616 - 552568
Alignment:
| Q |
6 |
gtttggtgttaatattattctagtacaaatttaattcttgattatctctttc |
57 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
552616 |
gtttggtgttaatattattctg---caaatttaattcttgattgtctctttc |
552568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University