View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9765_low_10 (Length: 226)
Name: NF9765_low_10
Description: NF9765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9765_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 15 - 204
Target Start/End: Complemental strand, 26438230 - 26438041
Alignment:
| Q |
15 |
gaattaaccatatgtccagtgtgcccacagcacaaaagaaagaaaagattgaagaagactttttaatccaaatcgttttggattaacaaataaacatcaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
26438230 |
gaattaaccatatgtccagtgtgcccacagcacaaaagaaagaaaagattgaagaggactttttaatccaaatagttttggattaacaaataaacat-aa |
26438132 |
T |
 |
| Q |
115 |
ttgttaatagtaa-tgtttaaaatggaaacttcaagagaccgcgcatatttatagtgaaaacaactgcagagccttccaacctacaaaatt |
204 |
Q |
| |
|
||| || ||| || ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26438131 |
acattactattaacaattgaaaatggaaacttcaagagaccgcgcatatttatagtgaaaccaactgcagagccttccaacctacaaaatt |
26438041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University