View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9765_low_10 (Length: 226)

Name: NF9765_low_10
Description: NF9765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9765_low_10
NF9765_low_10
[»] chr8 (1 HSPs)
chr8 (15-204)||(26438041-26438230)


Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 15 - 204
Target Start/End: Complemental strand, 26438230 - 26438041
Alignment:
15 gaattaaccatatgtccagtgtgcccacagcacaaaagaaagaaaagattgaagaagactttttaatccaaatcgttttggattaacaaataaacatcaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||    
26438230 gaattaaccatatgtccagtgtgcccacagcacaaaagaaagaaaagattgaagaggactttttaatccaaatagttttggattaacaaataaacat-aa 26438132  T
115 ttgttaatagtaa-tgtttaaaatggaaacttcaagagaccgcgcatatttatagtgaaaacaactgcagagccttccaacctacaaaatt 204  Q
       ||| || |||   || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
26438131 acattactattaacaattgaaaatggaaacttcaagagaccgcgcatatttatagtgaaaccaactgcagagccttccaacctacaaaatt 26438041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University