View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9765_low_8 (Length: 233)
Name: NF9765_low_8
Description: NF9765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9765_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 110 - 211
Target Start/End: Complemental strand, 15812874 - 15812773
Alignment:
| Q |
110 |
caagtactccaagccaaaaatagttttatatttttatgaaatcactaacactgcctttaattgagaggctcttggttacaaaatattgataatgtataaa |
209 |
Q |
| |
|
|||||| |||||||||||||| |||||||| ||||||||||||||||||| |||||| || ||||| |||||| || |||||||||||||||||||| |
|
|
| T |
15812874 |
caagtattccaagccaaaaattgttttatagttttatgaaatcactaacattgccttcaaaggagagtctcttgaatatgaaatattgataatgtataaa |
15812775 |
T |
|
| Q |
210 |
ca |
211 |
Q |
| |
|
|| |
|
|
| T |
15812774 |
ca |
15812773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 170 - 214
Target Start/End: Complemental strand, 15805081 - 15805037
Alignment:
| Q |
170 |
ttgagaggctcttggttacaaaatattgataatgtataaacaaag |
214 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15805081 |
ttgataggctcttggttacaaaatattgataatgtataaacaaag |
15805037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 15 - 63
Target Start/End: Complemental strand, 15812958 - 15812910
Alignment:
| Q |
15 |
cataggcaaagtcttctattatatgtgagttttctttatcacatctcat |
63 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
15812958 |
catatgcaaagtcttctattatatgtaagttttccttatcacatctcat |
15812910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 13 - 51
Target Start/End: Complemental strand, 15805119 - 15805081
Alignment:
| Q |
13 |
agcataggcaaagtcttctattatatgtgagttttcttt |
51 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15805119 |
agcatatgcaaagtcttctattatatgtgagttttcttt |
15805081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 60
Target Start/End: Complemental strand, 15799572 - 15799527
Alignment:
| Q |
15 |
cataggcaaagtcttctattatatgtgagttttctttatcacatct |
60 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
15799572 |
catatgcaaagtcttctactatatgtgagttttccttatcacatct |
15799527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 46
Target Start/End: Complemental strand, 15697064 - 15697033
Alignment:
| Q |
15 |
cataggcaaagtcttctattatatgtgagttt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15697064 |
cataggcaaagtcttctattatatgtgagttt |
15697033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 47
Target Start/End: Complemental strand, 15722285 - 15722253
Alignment:
| Q |
15 |
cataggcaaagtcttctattatatgtgagtttt |
47 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
15722285 |
cataggcaaagtcttctattacatgtgagtttt |
15722253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University