View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9766_low_11 (Length: 343)
Name: NF9766_low_11
Description: NF9766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9766_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 10 - 325
Target Start/End: Complemental strand, 18028941 - 18028626
Alignment:
| Q |
10 |
tctttcagttttcaggcttgcttcttccgtttgttttgataacttcactctctaccgtttagtttgttcacttcgacttttcgtccggtgttgttcgtgc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18028941 |
tctttcagttttcaggcttgcttcttccgtttgttttgataacttcactctctaccgtttagtttgttcacttcgacttttcgtccggtgttgttcgtgc |
18028842 |
T |
 |
| Q |
110 |
atctccgggctgttttctttgttctcaactggcttatctctcttccggcgaaggtgttatctttccggcgagatcagggttggttttccgacgagctcaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18028841 |
atctccgggctgttttctttgttctcaactggcttatctctcttccggcgaaggtgttatctttccggcgagatcagggttggttttccgacgagctcaa |
18028742 |
T |
 |
| Q |
210 |
ggtcggtttgttcacttagcagcttcagttattgcatcttttgggtttgtcactctccattgtagcggattctctcaggtgcgatataggtgggttcttt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18028741 |
ggtcggtttgttcacttagcagcttcagttattgcatcttttgggtttgtcactctccattgtagcggattctctgaggtgcgatataggtgggttcttt |
18028642 |
T |
 |
| Q |
310 |
gttttactggtttgtg |
325 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
18028641 |
gttttactggtttgtg |
18028626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University