View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9766_low_17 (Length: 277)
Name: NF9766_low_17
Description: NF9766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9766_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 47374418 - 47374156
Alignment:
| Q |
1 |
ccgtttcttagtttctctctttctttgcttatgtctcatgttctgaattattctaacatctctccttcatacaccaacacaccacttcagataaatttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47374418 |
ccgtttcttagtttctctctttctttgcttctgtctcatgttctgaattattctaacatctctccttcatacaccaacacaccacttcagatcaatttcc |
47374319 |
T |
|
| Q |
101 |
ctctcgatgcttcaatttctcattcaccaaccttatcaaagctctgaaatcctagtttctttcatgtttgtatgtcgcctttatcttgaagctttgaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47374318 |
ctctcgatgcttcaatttctcattcaccaaccttatcaaagctctgaaatcccagtttctttcatgtttgtatgtcgcctttatcttgaagctttgaaat |
47374219 |
T |
|
| Q |
201 |
cccaacctttttgaaactcgaaatcgtaactgaagggtactggataacccgattcaacccacc |
263 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47374218 |
cccaacctttttgaaacccgaaatcgtaactgaagggtaccggataacccgattcaacccacc |
47374156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University