View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9766_low_20 (Length: 253)
Name: NF9766_low_20
Description: NF9766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9766_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 188 - 241
Target Start/End: Original strand, 48611342 - 48611395
Alignment:
| Q |
188 |
agcttaagaagggatttgaaaatagttttcaaccagcagaaatagacacgcctt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48611342 |
agcttaagaagggatttgaaaatagttttcaaccagcagcaatagacacgcctt |
48611395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University