View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9766_low_22 (Length: 250)

Name: NF9766_low_22
Description: NF9766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9766_low_22
NF9766_low_22
[»] chr2 (1 HSPs)
chr2 (149-236)||(2694114-2694201)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 149 - 236
Target Start/End: Original strand, 2694114 - 2694201
Alignment:
149 taattgtcgttttagattgttcatagtttttaaggaaatgattagttgggttgattcctattactttcacatcgcctacctccttctc 236  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||    
2694114 taattgtcgttttagattgttcatagtttttaaggaaatgattagttgagttgattcctattactttcacatcgcctaccttcttctc 2694201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University