View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9766_low_26 (Length: 228)
Name: NF9766_low_26
Description: NF9766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9766_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 44676600 - 44676679
Alignment:
| Q |
18 |
agatatgatgacaatagcattctttttctgtagacccgtatatatgctctcagattttagatacgggcccattaactttt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44676600 |
agatatgatgacaatagcattctttttctgtagacccgtatatatgctctcagattttagatacgggcccattaactttt |
44676679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 44676750 - 44676791
Alignment:
| Q |
170 |
gggtgagaatgagtaaatagagaataatcatagcagtatatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44676750 |
gggtgagaatgagtaaatagagaataatcatagcagtatatt |
44676791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University