View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9768_high_10 (Length: 251)

Name: NF9768_high_10
Description: NF9768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9768_high_10
NF9768_high_10
[»] chr4 (1 HSPs)
chr4 (74-245)||(30137693-30137864)
[»] chr7 (1 HSPs)
chr7 (100-161)||(18758371-18758432)


Alignment Details
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 74 - 245
Target Start/End: Complemental strand, 30137864 - 30137693
Alignment:
74 cagaaacactgtccaaacannnnnnngttttctctagaaataattgagtcgttaacctattcaacaacgacgccaaagctcgactcattgccgccgatca 173  Q
    |||||||||||||||||||        ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||    
30137864 cagaaacactgtccaaacatttttttattttctctagaaataattgagtcgttaacctattcgacaacgacgccaaagctcgactcattgccaccgatca 30137765  T
174 ccggaaactcagctcatttaccaccggagctgtttatcccggcgaatgtaactctcttcacctctctgcttc 245  Q
    || |||||||| ||||||||||||| || || ||||| ||||||||| ||||||| ||| |||||| |||||    
30137764 ccagaaactcaactcatttaccaccagaactatttataccggcgaatataactctattcccctctcggcttc 30137693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 161
Target Start/End: Complemental strand, 18758432 - 18758371
Alignment:
100 gttttctctagaaataattgagtcgttaacctattcaacaacgacgccaaagctcgactcat 161  Q
    |||||||||||||| ||  || ||  |||||| |||||||||||||||| ||||||||||||    
18758432 gttttctctagaaacaaacgaatcactaacctcttcaacaacgacgccagagctcgactcat 18758371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University