View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9768_high_10 (Length: 251)
Name: NF9768_high_10
Description: NF9768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9768_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 74 - 245
Target Start/End: Complemental strand, 30137864 - 30137693
Alignment:
| Q |
74 |
cagaaacactgtccaaacannnnnnngttttctctagaaataattgagtcgttaacctattcaacaacgacgccaaagctcgactcattgccgccgatca |
173 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30137864 |
cagaaacactgtccaaacatttttttattttctctagaaataattgagtcgttaacctattcgacaacgacgccaaagctcgactcattgccaccgatca |
30137765 |
T |
|
| Q |
174 |
ccggaaactcagctcatttaccaccggagctgtttatcccggcgaatgtaactctcttcacctctctgcttc |
245 |
Q |
| |
|
|| |||||||| ||||||||||||| || || ||||| ||||||||| ||||||| ||| |||||| ||||| |
|
|
| T |
30137764 |
ccagaaactcaactcatttaccaccagaactatttataccggcgaatataactctattcccctctcggcttc |
30137693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 161
Target Start/End: Complemental strand, 18758432 - 18758371
Alignment:
| Q |
100 |
gttttctctagaaataattgagtcgttaacctattcaacaacgacgccaaagctcgactcat |
161 |
Q |
| |
|
|||||||||||||| || || || |||||| |||||||||||||||| |||||||||||| |
|
|
| T |
18758432 |
gttttctctagaaacaaacgaatcactaacctcttcaacaacgacgccagagctcgactcat |
18758371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University