View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9768_high_9 (Length: 294)
Name: NF9768_high_9
Description: NF9768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9768_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 8842136 - 8841859
Alignment:
| Q |
1 |
gaattctagctcagtactttggtttttcgaacaaaaatacaaaatttgtatgttttgtgaaatgtccaatctgaatccaacggccatcaatgtactgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8842136 |
gaattctagctcagtactttggttttacgaacaaaaatacaaaatttgtatgttttatgaaatgttcaatctgaatccaacggccatcaatgtactgaac |
8842037 |
T |
|
| Q |
101 |
ggataggtgcaaggttatcccaactacgaggagcctattttcgtaaatttctttgtaggagtcatggtttcaaattgtgatcgcctcatgaactttgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
8842036 |
ggataggtgcaaggttatcccaactacgaggagcctattttcgtaaatttttttataggagtcatggttttaaattgtgatcgcctcacgaactttgata |
8841937 |
T |
|
| Q |
201 |
tcacggaaaatcatagtcaaatgtgacttcagtcgttgtcacagagatatcaaaaattatcatattgcgtcttagatc |
278 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||| |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
8841936 |
tcacggaaaatcatagtcaaatgtgatttcagttgttgtcacggagatatcgaaaactatcatattgcgtcttagatc |
8841859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University