View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9768_low_20 (Length: 248)
Name: NF9768_low_20
Description: NF9768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9768_low_20 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 3863533 - 3863303
Alignment:
| Q |
18 |
gaaaagtccatagaattatggcacaagatcttctgtctttgtaggtaccgtctactttttggccgaagccacgagcttaagatggagtgtgcaggtgata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3863533 |
gaaaagtccatagaattatggcacaagatcttctgtctttgtaggtaccgtctaatttttggccgaagccacgagcttaagatggagtgtgcaggtgata |
3863434 |
T |
 |
| Q |
118 |
actgaatttaaacttcaaaattcttgtatgcaaacggatgctgcagtggttgtacaatcacaaggaagtggcaacattagagcttgtagtttcggacagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3863433 |
actgaatttaaacttcaaaattcttgtatgcaaacggatgctgcagtggttgtacaatcacaaggaagtggcaacattagagcttgtagtttcggacagc |
3863334 |
T |
 |
| Q |
218 |
ctcatgttgctgaaccagattagcagtacct |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |
|
|
| T |
3863333 |
ctcatgttgctgaaccagactagcagtacct |
3863303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University